|
10X Genomics
3′ sequencing and barcoding  3′ Sequencing And Barcoding, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3′ sequencing and barcoding/product/10X Genomics Average 90 stars, based on 1 article reviews
3′ sequencing and barcoding - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Molecular Instruments
hcr 3.0 barcode sequences Hcr 3.0 Barcode Sequences, supplied by Molecular Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hcr 3.0 barcode sequences/product/Molecular Instruments Average 90 stars, based on 1 article reviews
hcr 3.0 barcode sequences - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
10X Genomics
chromium 3’ rna-sequencing chemistry with feature barcoding Chromium 3’ Rna Sequencing Chemistry With Feature Barcoding, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chromium 3’ rna-sequencing chemistry with feature barcoding/product/10X Genomics Average 90 stars, based on 1 article reviews
chromium 3’ rna-sequencing chemistry with feature barcoding - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Oligos Etc
barcode oligos name sequence (5'-3') mcherry-bc16 fw Barcode Oligos Name Sequence (5' 3') Mcherry Bc16 Fw, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcode oligos name sequence (5'-3') mcherry-bc16 fw/product/Oligos Etc Average 90 stars, based on 1 article reviews
barcode oligos name sequence (5'-3') mcherry-bc16 fw - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
ChemGenes corporation
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); Barcoded Bead, Sequence (5’ To 3’): Toyopearl Linker Beads Tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30);/product/ChemGenes corporation Average 90 stars, based on 1 article reviews
barcoded bead, sequence (5’ to 3’): toyopearl-linker-beads- tttttttaagcagtggtatcaacgcagagtacjjjjjjjjjjjjnnnnnnnnvt(30); - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Solexa
3’-adapter barcoded small rna cdna library solexa-sequencing 3’ Adapter Barcoded Small Rna Cdna Library Solexa Sequencing, supplied by Solexa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3’-adapter barcoded small rna cdna library solexa-sequencing/product/Solexa Average 90 stars, based on 1 article reviews
3’-adapter barcoded small rna cdna library solexa-sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Biology of Reproduction
Article Title: What has single-cell RNA-seq taught us about mammalian spermatogenesis?
doi: 10.1093/biolre/ioz088
Figure Lengend Snippet: Mouse spermatogenesis single-cell RNA-seq datasets.
Article Snippet: Cell Rep Total cell number 1204 53 510 (from 2 P5, 1 P10, 1 P15, 1 P20, 1 P25, 1 P30, 1 P35, 2 8–9 week mice) 34 633 1200–2500 per sample (from 1 P6, 1 P14, 1 P18, 1 P25, 1 P30, 1 8week mice) 19 659 (>50 mice) 31 163 (from 21 adult mice, 30 P6 mice) 62 600 (from 11 to 38 week WT, Mlh3 KO, Cul4a KO, Hormad1 KO, and Cnp mice) Not mentioned 71 175 (80 from P1.5, 48 from P3.5, and 47 from P5.5) Interstitial steroidogenic progenitor cells (6362 cells), SCs (1932 cells), fetal Leydig cells (521 cells), primordial germ cells (483 cells), and endothelial cells (180 cells) from E16.5 2500 (1250 each from 2 mice) 181 (71 from P3 WT, 53 from P7 WT, 57 from Rhox10 KO P3) First-Wave + + – + – + – – + + – – + Unselected steady-state spermtogenesis – + + + – + + – – – – + – Sorted Spermatogonia + – + + – + + + – – – – – Sorted Spermatocytes + – + + – + + – – – – – – Sorted Spermatids + – + + – + + – – – – – – Somatic cells – Sertoli cells, Leydig cells, Myoid cells, Endothelial cells, Marcrophages Sertoli cells, Leydig cells, Myoid cells, Endothelial cells, Macrophage, Inntate Lymphosid Sertoli cells, Endothelial, Hematopoietic cells, Smooth muscle – Sertoli cells, Peritubular cells (adult) Sertoli cells, Leydig cells – – Sertoli cells Endothelial cells, fetal Leydig cells, Sertoli cells Sertoli cells, Leydig cells – Validation methods Knockout, ChIP-seq RNA scope, ChIP-seq IHC, smFISH IHC – IHC, qRT-PCR Knockout, IHC Knockout, Transplantation, Bulk RNA-seq, IHC IHC, Function (RA inhibitior) Knockout, ChIP-qPCR, IHC, WB Knockout in Sertoli cells – Knockout, IHC scRNA-seq Chemistry/Method 3′ sequencing and full length sequence (SMART-seq2) 3′ sequencing and
Techniques: Biomarker Discovery, Knock-Out, RNAscope, Transplantation Assay, Sequencing
Journal: Biology of Reproduction
Article Title: What has single-cell RNA-seq taught us about mammalian spermatogenesis?
doi: 10.1093/biolre/ioz088
Figure Lengend Snippet: Human spermatogenesis single-cell RNA-seq datasets.
Article Snippet: Cell Rep Total cell number 1204 53 510 (from 2 P5, 1 P10, 1 P15, 1 P20, 1 P25, 1 P30, 1 P35, 2 8–9 week mice) 34 633 1200–2500 per sample (from 1 P6, 1 P14, 1 P18, 1 P25, 1 P30, 1 8week mice) 19 659 (>50 mice) 31 163 (from 21 adult mice, 30 P6 mice) 62 600 (from 11 to 38 week WT, Mlh3 KO, Cul4a KO, Hormad1 KO, and Cnp mice) Not mentioned 71 175 (80 from P1.5, 48 from P3.5, and 47 from P5.5) Interstitial steroidogenic progenitor cells (6362 cells), SCs (1932 cells), fetal Leydig cells (521 cells), primordial germ cells (483 cells), and endothelial cells (180 cells) from E16.5 2500 (1250 each from 2 mice) 181 (71 from P3 WT, 53 from P7 WT, 57 from Rhox10 KO P3) First-Wave + + – + – + – – + + – – + Unselected steady-state spermtogenesis – + + + – + + – – – – + – Sorted Spermatogonia + – + + – + + + – – – – – Sorted Spermatocytes + – + + – + + – – – – – – Sorted Spermatids + – + + – + + – – – – – – Somatic cells – Sertoli cells, Leydig cells, Myoid cells, Endothelial cells, Marcrophages Sertoli cells, Leydig cells, Myoid cells, Endothelial cells, Macrophage, Inntate Lymphosid Sertoli cells, Endothelial, Hematopoietic cells, Smooth muscle – Sertoli cells, Peritubular cells (adult) Sertoli cells, Leydig cells – – Sertoli cells Endothelial cells, fetal Leydig cells, Sertoli cells Sertoli cells, Leydig cells – Validation methods Knockout, ChIP-seq RNA scope, ChIP-seq IHC, smFISH IHC – IHC, qRT-PCR Knockout, IHC Knockout, Transplantation, Bulk RNA-seq, IHC IHC, Function (RA inhibitior) Knockout, ChIP-qPCR, IHC, WB Knockout in Sertoli cells – Knockout, IHC scRNA-seq Chemistry/Method 3′ sequencing and full length sequence (SMART-seq2) 3′ sequencing and
Techniques: Biomarker Discovery, Sequencing